Journal of Crop Protection

Journal of Crop Protection

Reaction of commercial sugar‑beet cultivars to beet curly top Iran virus (BCTIV)

Document Type : Original Research

Authors
Department of Plant Pathology, Faculty of Agriculture, Tarbiat Modares University, Tehran, Iran.
10.48311/jcp.2025.76293.0
Abstract
Beet curly top Iran virus (BCTIV; family Geminiviridae, genus Becurtovirus, species Becurtovirus betae) is a widespread pathogen that reduces sugar beet yields in the Mediterranean and Middle East regions. This study aimed to investigate the reaction of seven commercial sugar beet cultivars to BCTIV to identify natural resistance to the virus. The cultivars were inoculated and maintained under greenhouse conditions. Virus accumulation was quantified at 56 days post-inoculation (dpi) through quantitative polymerase chain reaction (qPCR). The results showed that virus accumulation in Aria and Arta cultivars was lower than in other cultivars. On the other hand, Jolgeh, as a susceptible cultivar, exhibited the highest virus accumulation, which coincided with the most severe symptoms. When Jolgeh was inoculated with the virus, it exhibited the lowest greenness, photosynthesis, chlorophyll a and b, carotenoids, catalase, peroxidase, polyphenol oxidase, and proline compared to non-inoculated plants. Conversely, the Aria and Arta cultivars showed a smaller decline in the traits mentioned when inoculated with the virus. Collectively, the results of biochemical, physiological, and molecular assays revealed that the Aria and Arta cultivars were resistant to BCTIV infection. Since the virus has been reported in most sugar beet-growing areas in Iran, the Aria and Arta cultivars are recommended for cultivation in these regions.
 
 

 
Keywords
Subjects

 

Research Article

Reaction of commercial sugar‑beet cultivars to beet curly top Iran virus (BCTIV)

 

 

Roya Kazemi, Naser Safaie, Majid Pedram, Mohammad Reza Atighi and Masoud Shams-Bakhsh*

 

Department of Plant Pathology, Faculty of Agriculture, Tarbiat Modares University, Tehran, Iran.

 

Abstract: Beet curly top Iran virus (BCTIV; family Geminiviridae, genus Becurtovirus, species Becurtovirus betae) is a widespread pathogen that reduces sugar beet yields in the Mediterranean and Middle East regions. This study aimed to investigate the reaction of seven commercial sugar beet cultivars to BCTIV to identify natural resistance to the virus. The cultivars were inoculated and maintained under greenhouse conditions. Virus accumulation was quantified at 56 days post-inoculation (dpi) through quantitative polymerase chain reaction (qPCR). The results showed that virus accumulation in Aria and Arta cultivars was lower than in other cultivars. On the other hand, Jolgeh, as a susceptible cultivar, exhibited the highest virus accumulation, which coincided with the most severe symptoms. When Jolgeh was inoculated with the virus, it exhibited the lowest greenness, photosynthesis, chlorophyll a and b, carotenoids, catalase, peroxidase, polyphenol oxidase, and proline compared to non-inoculated plants. Conversely, the Aria and Arta cultivars showed a smaller decline in the traits mentioned when inoculated with the virus. Collectively, the results of biochemical, physiological, and molecular assays revealed that the Aria and Arta cultivars were resistant to BCTIV infection. Since the virus has been reported in most sugar beet-growing areas in Iran, the Aria and Arta cultivars are recommended for cultivation in these regions.

 

Keywords: Becurtovirus betae, Biochemical, Geminiviruses, Physiological traits

 

 

Introduction[1][2]

 

Sugar beet, Beta vulgaris subsp. Vulgaris, is a biennial, diploid plant from the family Chenopodiaceae that plays a significant role in the economy, and faces threats from pests and diseases. In Iran, the primary diseases affecting sugar beet include beet curly top disease, rhizomania, beet weariness caused by beet cyst nematode, and root rots (Harveson et al., 2009). Beet curly top virus (BCTV) was first reported in the late 19th century in the western United States (Bennett, 1971) and can infect more than 300 plant species, including crops, ornamentals, and weeds, from at least 44 plant families. The use of resistant cultivars, along with insecticide treatments, greatly reduces the incidence of beet curly top disease (Bennett, 1971; Velasquez-Valle et al., 2012). Nevertheless, infection of resistant sugar beet cultivars has been reported at early stages, increasing the incidence of this disease and causing heavy yield losses in recent years (Yıldırım et al., 2023).

Beet curly top Iran virus (BCTIV), also known as Becurtovirus betae, a species in the Becurtovirus genus of the family Geminiviridae, has been identified in Iran. It has been detected not only on sugar beet, but also on turnips, tomatoes, spinach, and various types of grass (Heydarnejad et al., 2007; Yazdi et al., 2008; Varsani et al., 2014). Recently, BCTIV has also been reported in Turkey (Yıldırım et al., 2022). BCTIV is naturally transmitted by the leafhopper Circulifer haematoceps, the dominant leafhopper species found in sugar beet fields in Iran, in a persistent-circulative manner (Taheri et al., 2012).

One effective way to manage this disease is to use resistant cultivars, and several studies have identified sources of resistance to BCTV. In one study, 29 commercial sugar beet hybrids were screened for resistance to the BCTV in a naturally infected field in Canyon County, and none were found to be resistant (Camp et al., 2005). In another study, based on visual rating, among 30 tested lines, 26 performed similarly to the resistant checks (Strausbaugh and Fenwick, 2019). Montazeri et al. (2016) screened 50 sugar beet lines for resistance to beet curly top virus (BCTIV, BCTV-C), and five of them were resistant to both viruses. In another study, five of 18 sugar beet cultivars were identified as tolerant, and no resistant cultivar was found against severe beet curly top virus (Fatahi et al., 2012). Under greenhouse conditions using infectious clones, 38 sugar beet genotypes were assessed for their susceptibility to either BCTV-Svr or BCTIV separately. As a result, ten and seven genotypes were found to be resistant to BCTV-Svr and BCTIV, respectively. Consequently, in a field experiment under natural virus infection, six genotypes were found to be resistant to BCTV-Svr and BCTIV (Saadati et al., 2021). Considering the broad host range and presence of BCTIV vector in most sugar beet cultivation areas of Iran, this study aimed to identify commercial cultivars resistant to BCTIV, and hypothesized that specific commercial cultivars exhibit biochemical traits associated with BCTIV resistance.

 

Materials and Methods

 

Plant growth and experimental conditions

Seven cultivars of sugar beet Beta vulgaris L., namely Arya, Arta, Sanetta, Bifort, Hadiya, S1_920833, and Jolgeh, were obtained from the Sugar Beet Seed Institute, Karaj, Iran. The plants were grown in an insect-free greenhouse at 25±2 °C with a 16 h of light and eight h of darkness photoperiod. All experiments were conducted in a completely randomized factorial design with two factors i.e. cultivars and virus inoculation, using 31 replicates. The experiment was repeated twice independently. Treatments were as follows: uninoculated control plants; inoculated plants with Agrobacterium tumefaciens strain LBA4404 harboring a plasmid without a virus fragment as a control; and those inoculated with the infectious clone of virus (V). The latter two were considered for all experiments.

 

Virus inoculation

The agroinoculation of plants was performed using the infectious clone of BCTIV [IR:Neg: B33P:-Sug:08], with the GenBank accession number JQ707949 (Heydarnejad et al., 2013), provided by Dr. J. Heydarnejad from Shahid Bahonar University of Kerman, Iran. Agro-inoculation was carried out using Agrobacterium tumefaciens strain LBA4404 harboring infectious clones of BCTIV. To perform this, it was grown in a liquid LB medium containing the antibiotics Kanamycin (50 μg/ml) and Rifampicin (50 μg/ml). Then it was kept on a shaker at 180 rpm until the OD600 reached 0.2-0.6 (Grimsley et al. 1986). Cells were precipitated by centrifugation at 6000 rpm for 10 minutes and then resuspended in sterile distilled water containing acetosyringone (50 mM). Agro-inoculation was performed by infiltrating leaves at the four-to-six leaf stage, around 40 days after sowing (Sedano et al., 2012). The symptoms were assessed using the method described before (Montazeri et al., 2016).

Quantitative PCR analysis (qPCR)

At 56 dpi, DNA was extracted from plant leaf tissue using the CTAB method (Doyle and Doyle, 1987). To evaluate virus accumulation in inoculated plants, specific primers targeting a 127 bp segment of the BCTIV were used in quantitative polymerase chain reaction (qPCR). The qPCR mixture (10 μl) contained the following components: 5 μl RealQ SYBR Green PCR master mix (Amplicon, Denmark), 2 μl distilled water, 1 μl of each primer (10 pmol/μL), and 1 μl (50 ng/μl) of DNA template, and the reactions were performed on an ABI StepOne Real-Time PCR System (USA), with four biological replicates, each having two technical replicates. The negative control contained all components used in the PCR reaction, except that the DNA template was replaced with distilled water. The qPCR data were analyzed using the relative quantification method, with SSU rDNA of B. vulgaris as the reference gene (Table 1). The results were analyzed using the 2-ΔΔCT method (Livak and Schmittgen, 2001).

 

Fresh and dry weight measurements

At sixty dpi of BCTIV, the aerial parts of the plants were cut off to measure the fresh weight. The plants were subsequently placed in paper envelopes and dried in an oven at 105 °C for two days, and their dry weights were measured.

 

Phytochemical measurement

Proline content was measured at 35 dpi (5 weeks after inoculation) as described by Carillo and Gibon (2011) and Astaraki and Shams-Bakhsh (2023) using a microplate reader (Epoch BioTek, USA), and the following formula was used to calculate proline.

 

 

Flavonoid content was assessed at 35 dpi according to the method described by Chang et al. (2002). Polyphenol oxidase (PPO), peroxidase (POX) (Siguemoto and Gut, 2017), and catalase (CAT) activities (Maehly and Chance, 1954) were estimated at 420, 470, and 240 nm, respectively, using a microplate reader (Epoch BioTek, USA). For each sample, 100 mg of leaf plant tissue was used to assess enzyme activity. All the measurements were performed in five biological replicates and three technical replicates.

 

Physiological parameters

The chlorophyll content of the leaves, indicative of greenness, was quantified using a SPAD device following calibration. For measuring photosynthesis, the Li-Cor instrument (Li-3000, USA) was utilized. The chlorophyll a, chlorophyll b, and carotenoid contents were estimated at 35 dpi Astaraki et al. (2020) using the methods of Warren (2008), at 665 nm, 652 nm, and 470 nm, respectively, using a microplate reader (Epoch BioTek, USA). The following formula was used to calculate the chlorophyll a, chlorophyll b, and carotenoid contents.

 

A652, = (A652 − blank)

 

A665, = (A665 − blank)

 

A470 = (A470 – blank)

 

Chl a (µg/mL) = 16.72 A665 – 9.16 A652

 

Chl b (µg/mL) = 34.09 A652 − 15.28 A665

 

Carotenoid = (1000 A470 – 1.63 Chla – 104.96 Chlb)/221

 

Statistical analysis

All statistical analyses were conducted using SAS 9.2 (SAS Institute Inc., Cary, NC). Analysis of variance (ANOVA) was performed using the GLM procedure, and tests of residual normality were conducted with the UNIVARIATE procedure. Categorical and ordinal data underwent rank transformation (e.g., the severity of virus symptoms). They were analyzed using the nonparametric methods developed by Shah and Madden (2004) via the GLM procedure in SAS. Means were differentiated via the least significant difference (LSD) test at a significance level of P ≤ 0.05. Analysis of the combined experiments was carried out using Minitab (Minitab 18.1).

 

Results

 

Symptom severity assessment

Symptoms were scored at 56 dpi, and among the seven examined cultivars, mild symptoms, including bright veins and slight vein swelling and crumpling, were observed on Aria, and Arta cultivars, while severe symptoms, including severe stunting, vein swelling, and crumpling of most leaves, severe leaf curling were observed on Hadiya and Jolgeh cultivars (Figs. 1 and 2). Results showed that the incubation period, from inoculation to symptom appearance, ranged from 13 to 29 days depending on the cultivar (Fig. 3), and a correlation was observed between the incubation period and symptom severity at 56 dpi.

 

 

Table 1 Primers used to quantify beet curly top Iran virus accumulation using qPCR.

 

Primer name and function

Forward (5′-3′)

Reverse (5′-3′)

Product size

Reference

DNA-BCTIV- (target)

CGCATCCCTCCTAATCCGAT

TGGCTAGTGGTGCATTTTGG

127bp

This study

SSU rDNA B. v ulgaris (reference)

CGTTCTTAGTTGGTGGAGCG

AAGATTACCCGGACCTGTCG

245bp

This study

 

 

Figure 1 Symptoms of beet curly top Iran virus on leaves of susceptible and resistant cultivars of sugar beet to beet curly top Iran virus. A: cultivar Jolgeh as susceptible cultivar with clear symptoms of severe curling, B: Cultivar Arya as resistant cultivar with no visible symptoms. 

 

 

Figure 2 Comparison of the symptom severity index of seven sugar beet cultivars inoculated with the beet curly top Iran virus 56 days post-inoculation under greenhouse conditions. The graph is based on the average of 31 replicates. Error bars indicate standard error (SE). Different letters represent significant differences (LSD test, P < 0.05).

 

Photosynthesis pigments, greenness, and photosynthesis

The data shown in Fig. 4 indicate that the levels of chlorophyll a, b, total chlorophyll, carotenoid, chlorophyll index, and photosynthesis in cultivars Arya and Arta were not significantly decreased except for total chlorophyll, chlorophyll index, and photosynthesis level in Arta upon inoculation with BCTIV. In cultivar Jolgeh, as the susceptible cultivar, all the mentioned parameters were significantly decreased. In other cultivars, including Sanetta, Bifort, Hadiya, and S1_920833, all parameters were significantly reduced upon inoculation with BCTIV, as observed in the susceptible cultivar Jolgeh.

 

 

Figure 3 Incubation period in seven sugar beet cultivars inoculated with the beet curly top Iran virus under greenhouse conditions. The graph is based on the average of 31 replicates. Error bars indicate standard error (SE). Different letters represent significant differences (LSD test, P < 0.05).

 

Enzyme activity measurements

To investigate the defense responses of different cultivars after virus inoculation, biochemical assays for photosynthetic pigments, greenness, and photosynthesis were performed at 35 dpi. A notable decrease in POX, PPO, and CAT was observed in the Jolgeh cultivar for all three enzymes. Conversely, the resistant cultivars, Arta and Arya, exhibited a general trend toward increased accumulation of the abovementioned defense-related enzymes following infection by BCTIV. The rest of the cultivars either showed suppression of defense-related enzymes or remained unaffected after virus inoculation (Fig. 5A). The cultivars Arya and Arta showed significantly higher proline and flavonoid contents than their control samples (Fig. 5B and 5C).

 

Growth parameters

Growth parameters, including total fresh and dry weights of shoots and roots, were evaluated. The Jolgeh cultivar exhibited the greatest reductions in both fresh and dry weight compared to the other cultivars (Fig. 6).

 

Replication of BCTIV

Accumulation of BCTIV in different cultivars

The results obtained from the qPCR showed a significant difference in BCTIV accumulation among the cultivars (Fig. 7). The titer of BCTIV DNA was highest in the Jolgeh cultivar, and lowest in the Arya and Arta cultivars. No significant difference was observed between the Arya and Arta cultivars in accumulation of virus. The four other cultivars, however, showed different levels of virus accumulation, where Hadiya exhibited the highest accumulation compared to Sanneta, Bifort, and S1_920833.

 

Discussion

 

Among all approaches to managing plant disease, the use of resistant cultivars, particularly for viral diseases, is of great importance. Most other methods, particularly the commonly used chemical treatments, are ineffective against viruses except in cases where viral control is achieved indirectly by targeting insect vectors. The initial step in applying resistant cultivars is identifying the source of resistance. In this study, seven sugar beet cultivars were screened for resistance against BCTIV, and the underlying biochemical mechanisms were investigated. The morphological observations revealed that Arya and Arta exhibited fewer symptoms of virus infection. In contrast, the remaining cultivars, particularly Jolgeh, showed bright veins, minor vein swelling, and crumpling symptoms. In line with morphological observations, measurements of virus accumulation in the examined cultivars showed that Arta and Arya had lower virus accumulation than the others, indicating lower susceptibility to infection. In BCTIV-inoculated plants of the cultivars Arta and Arya, symptoms such as leaf curling, vein swelling, and reduced plant growth developed more slowly, with severe symptoms persisting for up to two months post-inoculation, as observed in previous studies (Soleimani et al., 2013; Jahanbin et al., 2015; Saadati et al., 2021).

 

 

 

Figure 4 Chlorophyll a, b, total chlorophyll, carotenoid, chlorophyll index, and photosynthesis level in seven sugar beet cultivars in plants inoculated with the beet curly top Iran virus under greenhouse conditions in comparison with their respective non-inoculated control plants. Plants were inoculated with A. tumefaciens harboring a plasmid with a virus fragment as virus-inoculated plants and without a virus fragment as control plants. Plants were harvested at 35 dpi. (A), chlorophyll a, (B), chlorophyll b content, (C), total chlorophyll, (D), Carotenoids, (E), Chlorophyll index, and (F), photosynthesis level. The graphs are based on the average of three biological replicates, each consisting of a pool of three plants. Error bars indicate standard error (SE). Different letters represent significant differences (LSD test, P < 0.05).

Figure 5 Defense-related enzymes, including peroxidase (POX), polyphenol oxidase (PPO) and catalase (CAT) levels as well as proline and flavonoids in seven sugar beet cultivars in plants inoculated with the beet curly top Iran virus under greenhouse conditions in comparison with their respective non-inoculated control plants. Plants were inoculated with Agrobacterium tumefaciens harboring a plasmid without a virus fragment as a control and with a virus fragment in inoculated plants, plants were harvested at 35 dpi. (A), POX, PPO and CAT levels (B), proline level (C), flavonoids. The graphs are based on the average of three biological replicates, each consisting of a pool of 3 plants. Error bars indicate standard error (SE). Different letters represent significant differences (LSD test, P < 0.05).

 

 

The extent of virus accumulation in plant tissue is a critical factor in assessing plant resistance. Lower virus build-up in plant tissues signifies greater resistance, while higher accumulation indicates increased susceptibility. The findings of present study are consistent with the results of previous studies (Lapidot, 2002; Fatahi et al., 2012; Majidi et al., 2017; Saadati et al., 2021). The qPCR results aligned with symptom severity outcomes, indicating that cultivars with more severe symptoms exhibited greater viral accumulation than those with mild symptoms (Mehetre et al., 2021). Other methods yielded the same results, with a direct, positive correlation between symptom severity and ELISA uptake rate at each rank (Montazeri et al., 2016). In the current study, viral infections in plants resulted in significant alterations in photosynthesis and photosynthetic pigments across infected cultivars. The Jolgeh cultivar exhibited the most substantial decrease in photosynthesis and photosynthetic pigments, correlating with a relatively high symptom severity. In contrast, the Aria and Arta cultivars experienced a much lower rate of reduction in photosynthesis and photosynthetic pigments. This feature has been reported in the responses of other host plants to this virus or other plant viruses too. For instance, in common bean, pepper, and sugar beet plants infected with BCTIV and BCTV-Svr, a decrease in the photosynthesis rate and the content of chlorophyll a and b has been observed (Astaraki et al., 2020). Susceptible bean cultivars exhibited significant decreases in photosynthetic pigments following pathogen infection, resulting in impaired photosynthesis (Lobato et al., 2010).

 

 

 

Figure 6 Growth parameters including total fresh and dry weight of shoots and roots of seven sugar beet cultivars in plants inoculated with the beet curly top Iran virus under greenhouse conditions in comparison with their respective non-inoculated control plants. Plants were inoculated with Agrobacterium tumefaciens harboring a plasmid without a virus fragment as a control and with a virus fragment in inoculated plants. Plants were harvested at 60 dpi. (A), total fresh weight of shoots, (B), total dry weight of shoots. The graphs are based on the average of 31 plants. Error bars indicate standard error (SE). Different letters represent significant differences (LSD test, P < 0.05).

 

 

Moreover, various studies have shown that viral infection damages chloroplast structure, decreases the number of chloroplasts per cell, and increases the activity of enzymes involved in chlorophyll breakdown, leading to reduced chlorophyll levels and photosynthesis rates (Zhang et al., 2014; Wang et al., 2020). When two sugar beet lines—one susceptible (Z-10) and one resistant (9BB6090)—were inoculated with two isolates (CHF and Logan) of BCTV, the rate of photosynthesis decreased in both lines, with the susceptible line experiencing a greater reduction than the resistant line. Similarly, chlorophyll content was affected by viral disease, with a greater reduction observed in the susceptible line (Swiech et al., 2001). During the infection period, a decrease in photosynthetic pigments was also reported in rice cultivars infected with rice tungro virus. In this study, photosynthetic pigments in resistant lines were 5.8%, while in susceptible lines they were 82.5% compared to their respective controls (Patel et al., 2018). This decrease is a strategy employed by resistant plants to enhance their ability to mitigate damage caused by infection. Resistant genotypes have a more effective protective system against pigment damage caused by the infection (Chen et al., 2015; Cheaib and Killiny, 2025).

 

 

Figure 7 Assessment of relative virus accumulation in different cultivars upon inoculation with BCTIV using qPCR at 56 dpi. The data represent the average of four biological replicates, each with two technical replicates. Relative expression was calculated using the 2-ΔΔCT method and statistically analysed using the LSD test at the 5% significance level. Different letters denote statistical differences.

 

In this study, proline levels were significantly increased in the resistant cultivar Arya, remained unaffected in other cultivars, and decreased in Sanetta. These findings are in line with previous studies, as proline has been shown to have a higher content in resistant cultivars (Saadati et al., 2022; Astaraki et al., 2023). Proline is a crucial component of plant defense mechanisms, functioning as a vital osmolyte and a potent non-enzymatic antioxidant (Ahmed et al., 2017). It helps maintain cellular integrity by balancing osmotic pressure under stressful conditions (Dar et al., 2016). Numerous studies have documented an increase in proline content in host-pathogen interactions, and the increase observed here following viral inoculation aligns with these findings (Gupta et al., 2020; Mahfouze et al., 2020; Sofy et al., 2020; Singh et al., 2021; Soni et al., 2022). In the case of flavonoids, the resistant cultivars Arya and Arta showed accumulation upon BCTIV infection, while other cultivars remained unaffected. Flavonoids primarily act as antioxidants, preventing viral attachment and entry into cells while bolstering cellular defense mechanisms (Friedman, 2007; Zakaryan et al., 2017). In watermelon, flavonoids were found to be significantly increased in resistant cultivars against cucumber green mottle mosaic virus (CGMMV), indicating their role in enhancing resistance through metabolic pathways (Liu et al., 2023).

Except for Aria and Arta, all cultivars experienced a decrease in total fresh and dry weights in BCTIV-inoculated plants compared to non-inoculated control plants. Pathogens impair plant growth by diverting resources from growth to defense mechanisms (Lee et al., 2016). Resistant onion plants exhibited less symptom appearance and growth defects comparing susceptible cultivars upon onion yellow dwarf virus infection (Corrado et al., 2024).

Upon pathogen attack, reactive oxygen species (ROS) are generated to activate defense signaling pathways and directly kill pathogens through toxic effects. To maintain ROS balance, plants have developed antioxidant systems that mitigate excess ROS accumulation through enzymatic and non-enzymatic reactions (Mittler, 2002). Peroxidase, one of the first enzymes to respond to plant pathogens (Sulman et al., 2001), plays a crucial role in lignin and suberin biosynthesis. Pathogen infections induce peroxidase activity in plant tissues, with greater increases observed in resistant plants than in susceptible ones (Retig, 1974). In wheat cultivars infected by Pyricularia oryzae, higher antioxidant enzyme activities, such as catalase and peroxidase, have been observed in resistant plants compared to susceptible ones (Debona et al., 2012). Consistent with previous studies, the resistant cultivars Arta and Aria exhibited higher antioxidant activity than susceptible cultivars. The ability of plants to resist pathogens depends significantly on increased accumulation and activity of defense-related enzymes. Research has shown that oxidative enzymes, such as PPO and POX, play a crucial role in enhancing plant disease resistance (Srivastava, 1987). PPOs catalyze the oxygen-dependent oxidation of phenols to quinones, which act as antibiotics and toxic agents against pathogens (Dahlem Junior et al., 2022). Quinones also participate in signal transduction by activating leucine-rich repeat receptor-like kinases (Laohavisit et al., 2020). In this study, resistant cultivars exhibited elevated PPO activity upon viral infection. The increase in defense enzyme activity observed in this study aligns with previous findings (Madhusudhan et al., 2009; Papaiah and Narasimha, 2014; Siddique et al., 2014; Soni et al., 2022; Mafakheri et al., 2024). The activity of POX, PPO, and phenylalanine ammonia-lyase enzymes increased in bean plants infected by the tomato leaf curl Palampur virus (Astaraki et al., 2023). Similarly, the activity of POX and PPO enzymes increased in sugar beet plants treated with fungal and bacterial antagonists against the beet curly top virus‑Sever (Mafakheri et al., 2024). Additionally, an examination of chemical changes in susceptible and resistant mung bean cultivars infected with mung yellow mosaic virus revealed a significant increase in PPO activity in resistant cultivars, whereas a decrease was observed in susceptible cultivars (Madhumitha et al., 2020).

 

Conclusion

 

In conclusion, the present study highlights the use of the resistant varieties Aria and Arta for controlling BCTIV in sugar beet cultivation. They remained resistant, with decreased viral accumulation, reduced symptom expression, and preserved photosynthetic capacity, all of which contribute to increased plant vigor and yield. In addition, they exhibited enhanced biochemical defense responses, including increased proline and flavonoid contents, as well as increased antioxidant enzyme activities as the underlying mechanism of resistance. They are advised to be tested for natural infection under field conditions before cultivation in most areas where BCTIV infection has been reported. Resistance resources are crucial in breeding programs. Therefore, the resistant sugar beet cultivars mentioned in this study have potential for use in sustainable disease management programs.

 

Acknowledgments

 

We would like to thank the Sugar Beet Seed Institute in Karaj, Iran, for providing the seeds of the cultivars used in this study. We also thank Tarbiat Modares University for providing the necessary facilities and financial support.

 

References

 

Ahmed, M., Hassan, F., Qadir, G., Shaheen, F. A. and Aslam, M. A. 2017. Response of proline accumulation in bread wheat (Triticum aestivum L.) under rainfed conditions. Journal of Agricultural Meteorology, 73: 147-155.

Astaraki, S., Atighi, M. R. and Shams-Bakhsh, M. 2023. Screening for tomato leaf curl Palampur virus resistance in common bean (Phaseolus vulgaris L.) cultivars through phytochemical characterization and enzyme activity analysis. Physiological and Molecular Plant Pathology, 126: 102043.

Astaraki, S., Safaie, N. and Bakhsh, M. S. 2020. Reaction of sugar beet, pepper and bean plants to co-infection with cucumber mosaic virus and beet curly top viruses. Iranian Journal of Plant Pathology, 56: 221-236.

Bennett, C. W. 1971. The Curly Top Disease of Sugarbeet and Other Plants. American Phytopathological Society, St. Paul.

Camp, S., Foote, P., Strausbaugh, C. A. and Gillen, A. M. 2005. Evaluation of commercial sugarbeet hybrids for resistance to beet curly top in Canyon county, ID, 2004. Biological and Cultural Tests for Control of Plant Diseases, 20: FC023.

Carillo, P. and Gibon, Y. 2011. Protocol: extraction and determination of proline. PrometheusWiki, 1-5.

Chang, C. C., Yang, M. H., Wen, H. M. and Chern, J. C. 2002. Estimation of total flavonoid content in propolis by two complementary colometric methods. Journal of Food and Drug Analysis, 10: 178-182.

Cheaib, A. and Killiny, N. 2025. Photosynthesis responses to the infection with plant pathogens. Molecular Plant-Microbe Interactions, 38: 9-29.

Chen, Y. E., Cui, J. M., Su, Y. Q., Yuan, S., Yuan, M. and Zhang, H. Y. 2015. Influence of stripe rust infection on the photosynthetic characteristics and antioxidant system of susceptible and resistant wheat cultivars at the adult plant stage. Frontiers in Plant Science, 6: 1-11.

Corrado, C. L., Micali, G., Mauceri, A., Bertin, S., Sunseri, F., Abenavoli, M. R. and Tiberini, A. 2024. Study on italian onion cultivars/ecotypes towards onion yellow dwarf virus (OYDV) infection. Horticulturae, 10.

Dahlem Junior, M. A., Nguema Edzang, R. W., Catto, A. L. and Raimundo, J. M. 2022. Quinones as an efficient molecular scaffold in the antibacterial/antifungal or antitumoral arsenal. International Journal of Molecular Sciences, 23.

Dar, M. I., Naikoo, M. I., Rehman, F., Naushin, F. and Khan, F. A. 2016. Proline accumulation in plants: roles in stress tolerance and plant development. In: Iqbal, N., Nazar, R. and Khan, N. A., (Eds.), Osmolytes and Plants Acclimation to Changing Environment: Emerging Omics Technologies. Springer India, pp. 155-166.

Debona, D., Rodrigues, F. Á., Rios, J. A. and Nascimento, K. J. T. 2012. Biochemical changes in the leaves of wheat plants infected by Pyricularia oryzae. Phytopathology, 102: 1121-1129.

Doyle, J. J. and Doyle, J. L. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin, 19: 11-15.

Fatahi, Z., Behjatnia, S. A. A., Afsharifar, A., Hamzehzarghani, H. and Izadpanah, K. 2012. Screening of sugar beet cultivars for resistance to Iranian isolate of beet severe curly top virus using an infectious clone of the virus. Iranian Journal of Plant Pathology, 48: 111-121.

Friedman, M. 2007. Overview of antibacterial, antitoxin, antiviral, and antifungal activities of tea flavonoids and teas. Molecular Nutrition & Food Research, 51: 116-134.

Grimsley, N., Hohn, I., Hohn, T. and Waldent, R. 1986. “Agroinfection,” an alternative route for viral infection of plants by using the Ti plasmid. Proceedings of the National Academy of Sciences, 83: 3282-3286.

Gupta, A., Patil, M., Qamar, A. and Senthil-Kumar, M. 2020. ath-miR164c influences plant responses to the combined stress of drought and bacterial infection by regulating proline metabolism. Environmental and Experimental Botany, 172: 103998.

Harveson, R., Hanson, L. and Hein, G. 2009. Compendium of Beet Diseases and Pests. American Phytopathological Society, APS Press.

Heydarnejad, J., Hosseini Abhari, E., Bolok Yazdi, H. R. and Massumi, H. 2007. Curly top of cultivated plants and weeds and report of a unique curtovirus from Iran. Journal of Phytopathology, 155: 321-325.

Heydarnejad, J., Keyvani, N., Razavinejad, S., Massumi, H. and Varsani, A. 2013. Fulfilling Koch’s postulates for beet curly top Iran virus and proposal for consideration of new genus in the family Geminiviridae. Archives of Virology, 158: 435-443.

Jahanbin, D., Izadpanah, K. and Behjatnia, S. A. A. 2015. Comparison of natural and experimental host range of beet severe curly top, beet curly top Iran and tomato yellow leaf curl viruses. Iranian Journal of Plant Pathology, 51: 505-521.

Laohavisit, A., Wakatake, T., Ishihama, N., Mulvey, H., Takizawa, K., Suzuki, T. and Shirasu, K. 2020. Quinone perception in plants via leucine-rich-repeat receptor-like kinases. Nature, 587: 92-97.

Lapidot, M. 2002. Screening common bean (Phaseolus vulgaris) for resistance to tomato yellow leaf curl virus. Plant Disease, 86: 429-432.

Lee, D., Ahn, S., Cho, H. Y., Yun, H. Y., Park, J. H., Lim, J., Lee, J. and Kwon, S. W. 2016. Metabolic response induced by parasitic plant-fungus interactions hinder amino sugar and nucleotide sugar metabolism in the host. Scientific Reports, 6: 37434.

Liu, M., Kang, B., Wu, H., Aranda, M. A., Peng, B., Liu, L., Fei, Z., Hong, N. and Gu, Q. 2023. Transcriptomic and metabolic profiling of watermelon uncovers the role of salicylic acid and flavonoids in the resistance to cucumber green mottle mosaic virus. Journal of Experimental Botany, 74: 5218-5235.

Livak, K. J. and Schmittgen, T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods, 25: 402-408.

Lobato, A. K. S., Gonçalves-Vidigal, M. C., Vidigal Filho, P. S. andrade, C. A. B., Kvitschal, M. V. and Bonato, C. M. 2010. Relationships between leaf pigments and photosynthesis in common bean plants infected by anthracnose. New Zealand Journal of Crop and Horticultural Science, 38: 29-37.

Madhumitha, B., Karthikeyan, A., Devi, G. P., Aiyanathan, K. E. A. and Sudha, M. 2020. Comparative evaluation of biochemical changes in the leaves of resistant and susceptible mungbean plants infected by mungbean yellow mosaic virus. Research Journal of Biotechnology, 15: 47-52.

Madhusudhan, K. N., Srikanta, B. M., Shylaja, M. D., Prakash, H. S. and Shetty, H. S. 2009. Changes in antioxidant enzymes, hydrogen peroxide, salicylic acid and oxidative stress in compatible and incompatible host-tobamovirus interaction. Journal of Plant Interactions, 4: 157-166.

Maehly, A. and Chance, B. 1954. The assay of catalases and peroxidases. Methods of Biochemical Analysis, 357-408.

Mafakheri, K., Astaraki, S., Safaie, N. and Shams-bakhsh, M. 2024. Seed bio-/chemo-priming affects the reaction of sugar beet plants to beet curly top virus-Svr. European Journal of Plant Pathology, 169: 473-482.

Mahfouze, H. A., Dougdoug, N. K. El, and Mahfouze, S. A. 2020. Virucidal activity of silver nanoparticles against banana bunchy top virus (BBTV) in banana plants. Bulletin of the National Research Centre, 44: 1-11.

Majidi, A., Hamzehzarghani, H., Izadpanah, K. and Behjatnia, S. A. A. 2017. Interaction between beet curly top Iran virus and the severe isolate of beet curly top virus in three selective sugar beet cultivars. Journal of Plant Pathology, 99: 381-389.

Mehetre, G. T., Leo, V. V., Singh, G., Sorokan, A., Maksimov, I., Yadav, M. K., Upadhyaya, K., Hashem, A., Alsaleh, A. N., Dawoud, T. M., Almaary, K. S. and Singh, B. P. 2021. Current developments and challenges in plant viral diagnostics: A systematic review. Viruses, 13: 1-31.

Mittler, R. 2002. Oxidative stress, antioxidants and stress tolerance. Trends in Plant Science, 7: 405-410.

Montazeri, R., Shams-Bakhsh, M., Mahmoudi, S. B. and Rajabi, A. 2016. Evaluation of sugar beet lines for resistance to beet curly top viruses. Euphytica, 210: 31-40.

Papaiah, S. and Narasimha, G. 2014. Peroxidase and polyphenol oxidase activities in healthy and viral infected sunflower (Helianthus annuus L.) leaves. BioTechnology: An Indian Journal, 9: 1-5.

Patel, S. K., Rajeswari, B. and Krishnaveni, D. 2018. Effect of rice tungro disease (RTD) on physiological changes of promising effect of rice tungro disease ( RTD ) on physiological changes of promising rice genotypes. International Journal of Agriculture Environment and Biotechnology, 999-1008.

Retig, N. 1974. Changes in peroxidase and polyphenoloxidase associated with natural and induced resistance of tomato to Fusarium wilt. Physiological Plant Pathology, 4: 145-150.

Saadati, M., Ayyari, M. and Shams-Bakhsh, M. 2022. Effect of the cucumber mosaic virus-Fny infection on the physiological and phytochemical properties of three green basil (Ocimum basilicum L.) landraces. Iranian Journal of Plant Pathology, 57: 303-319.

Saadati, M., Rajabi, A. and Shams-Bakhsh, M. 2021. Identification of resistant sugar beet (Beta vulgaris L.) genotypes against beet curly top disease. Journal of Agricultural Science and Technology, 23: 473-484.

Sedano, M., Lam, N., Escobar, I., Cross, T., Hanson, S. F. and Creamer, R. 2012. Application of vascular puncture for evaluation of curtovirus resistance in chile pepper and tomato. Journal of Phytopathology, 160: 120-128.

Shah, D. A. and Madden, L. V. 2004. Nonparametric analysis of ordinal data. Phytopathology, 94: 33-43.

Siddique, Z., Akhtar, K. P., Hameed, A., Sarwar, N., Imran-Ul-Haq, and Khan, S. A. 2014. Biochemical alterations in leaves of resistant and susceptible cotton genotypes infected systemically by cotton leaf curl Burewala virus. Journal of Plant Interactions, 9: 702-711.

Siguemoto, É. S. and Gut, J. A. W. 2017. Validation of spectrophotometric microplate methods for polyphenol oxidase and peroxidase activities analysis in fruits and vegetables. Food Science and Technology, 37: 148-153.

Singh, Y. J., Grewal, S. K. and Gill, R. K. 2021. Proline metabolism and phenylpropanoid pathway act independently in conferring resistance against yellow mosaic virus infection in black gram. Physiological and Molecular Plant Pathology, 116: 101713.

Sofy, A. R., Dawoud, R. A., Sofy, M. R., Mohamed, H. I., Hmed, A. A. and El-Dougdoug, N. K. 2020. Improving regulation of enzymatic and non-enzymatic antioxidants and stress-related gene stimulation in cucumber mosaic cucumovirus-infected cucumber plants treated with glycine betaine, chitosan and combination. Molecules, 25: 2341.

Soleimani, R., Matic, S., Taheri, H., Behjatnia, S. A. A., Vecchiati, M., Izadpanah, K. and Accotto, G. P. 2013. The unconventional geminivirus beet curly top Iran virus: Satisfying Koch’s postulates and determining vector and host range. Annals of Applied Biology, 162: 174-181.

Soni, S. K., Mishra, M., Mishra, M., Kumari, S., Saxena, S., Shukla, V., Tiwari, S. and Shirke, P. 2022. Papaya leaf curl virus (PaLCuV) infection on papaya (Carica papaya L.) plants alters anatomical and physiological properties and reduces bioactive components. Plants, 11: 579.

Srivastava, S. K. 1987. Peroxidase and poly‐phenol oxidase in Brassica juncea plants infected with Macrophomina phaseolina (Tassai) goid. and their Implication in Disease Resistance. Journal of Phytopathology, 120: 249-254.

Strausbaugh, C. A. and Fenwick, A. L. 2019. Beet curly top resistance in USDA-ARS Ft. Collins germplasm, 2018. Plant Disease Management Reports, 13.

Sulman, M., Fox, G., Osman, A., Inkerman, A., Williams, P. and Michalowitz, M. 2001. Relationship between total peroxidase activity and susceptibility to black point in mature grain of some barley cultivars. Proceeding 10th Australian Barley Technical Symposium, 16-20.

Swiech, R., Browning, S., Molsen, D., Stenger, D. C. and Holbrook, G. P. 2001. Photosynthetic responses of sugar beet and Nicotiana benthamiana Domin. infected with beet curly top virus. Physiological and Molecular Plant Pathology, 58: 43-52.

Taheri, H., Izadpanah, K. and Behjatnia, S. A. A. 2012. Circulifer haematoceps, the vector of the beet curly top Iran virus. Iranian Journal of Plant Pathology, 48.

Varsani, A., Martin, D. P., Navas-Castillo, J., Moriones, E., Hernández-Zepeda, C., Idris, A., Murilo Zerbini, F. and Brown, J. K. 2014. Revisiting the classification of curtoviruses based on genome-wide pairwise identity. Archives of Virology, 159: 1873-1882.

Velasquez-Valle, R., Mena-Covarrubias, J., Reveles-Torres, L. R., Argüello-Astorga, G. R., Salas-Luevano, M. A. and Mauricio-Castillo, J. A. 2012. First report of beet mild curly top virus in dry bean in Zacatecas, Mexico. Plant Disease, 96: 771-771.

Wang, K. L., Deng, Q. Q., Chen, J. W. and Shen, W. K. 2020. Physiological and molecular mechanisms governing the effect of virus-free chewing cane seedlings on yield and quality. Scientific Reports, 10: 1-11.

Warren, C. R. 2008. Rapid measurement of chlorophylls with a microplate reader. Journal of Plant Nutrition, 31: 1321-1332.

Yazdi, H. R. B., Heydarnejad, J. and Massumi, H. 2008. Genome characterization and genetic diversity of beet curly top Iran virus: A geminivirus with a novel nonanucleotide. Virus Genes, 36: 539-545.

Yıldırım, K., Kavas, M., Kaya, R., Seçgin, Z., Can, C., Sevgen, I., Saraç, Ç. G. and Tahan, V., 2022. Genome-based identification of beet curly top Iran virus infecting sugar beet in Turkey and investigation of its pathogenicity by agroinfection. Journal of Virological Methods, 300: 114380.

Yıldırım, K., Kavas, M., Küçük, İ. S., Seçgin, Z. and Saraç, Ç. G. 2023. Development of highly efficient resistance to beet curly top Iran virus (Becurtovirus) in sugar beet (B. vulgaris) via CRISPR/Cas9 system. International Journal of Molecular Sciences, 24.

Zakaryan, H., Arabyan, E., Oo, A. and Zandi, K. 2017. Flavonoids: promising natural compounds against viral infections. Archives of Virology, 162: 2539-2551.

Zhang, Y., Xie, Z., Wang, R., Kutcher, H. R., Wang, Y. and Guo, Z. 2014. Single and mixed viral infection reduced growth and photosynthetic pigment content, damaged chloroplast ultrastructure and enhanced virus accumulation in oriental lily (Lilium auratum cv. Sorbonne). Philippine Agricultural Scientist, 97(2): 138-147.



 

واکنش ارقام تجاری چغندرقند به ویروس پیچیدگی برگ چغندر  (BCTIV)

 

رویا کاظمی، ناصر صفایی، مجید پدرام، محمدرضا عتیقی و مسعود شمس بخش*

 

گروه بیماری­شناسی گیاهی، دانشکده کشاورزی، دانشگاه تربیت مدرس، تهران، ایران.

پست الکترونیکی نویسنده مسئول مکاتبه: shamsbakhsh@modares.ac.ir

دریافت: 25 مرداد 1404؛ پذیرش: 26 مهر 1404

 

چکیده: ویروس ایرانی پیچیدگی برگ چغندرقند (BCTIV) خانواده Geminiviridae، جنس Becurtovirus، گونه Becurtovirus betae بیمارگری است که عملکرد چغندرقند را در مناطق مدیترانه و خاورمیانه کاهش می‌دهد. این مطالعه با هدف بررسی واکنش هفت رقم تجاری چغندرقند به BCTIV برای شناسایی مقاومت طبیعی در برابر ویروس انجام شد. ارقام مایه­زنی شده در شرایط گلخانه نگه­داری شدند. تجمع ویروس در ۵۶ روز پس از مایه‌زنی (dpi) از طریق واکنش زنجیره‌ای پلیمراز کمی (qPCR)  اندازه‌گیری شد. نتایج نشان داد که تجمع ویروس در ارقام آریا و آرتا کم­تر از سایر ارقام بود. از سوی دیگر، جلگه، به­عنوان یک رقم حساس، بیش­ترین تجمع ویروس و شدت علائم را نشان داد. هم­چنین رقم جلگه کاهش بیش­تری در سبزینگی، فتوسنتز، کلروفیل a و b، کاروتنوئیدها، کاتالاز، پراکسیداز، پلی فنل اکسیداز و پرولین را بعد از آلودگی به ویروس در مقایسه با گیاهان شاهد نشان داد. برعکس، ارقام آریا و آرتا کاهش کم­تری در صفات ذکر شده بعد از آلودگی با ویروس در مقایسه با گیاهان شاهد نشان دادند. درمجموع، نتایج سنجش‌های بیوشیمیایی، فیزیولوژیک و مولکولی نشان داد که ارقام آریا و آرتا در برابر آلودگی به BCTIV مقاوم هستند. از آن­جایی که این ویروس در اکثر مناطق چغندرکاری ایران گزارش شده است، ارقام آریا و آرتا برای کشت در این مناطق توصیه می‌شوند.

 

واژگان کلیدی: Becurtovirus betae، بیوشیمیایی، Geminiviruses، صفات فیزیولوژیک



Handling Editor: Heshmatollah Rahimian


 

*Corresponding authors: shamsbakhsh@modares.ac.ir

Received: 16 August 2025, Accepted: 18 October 2025

Published online: 11 November 2025

Ahmed, M., Hassan, F., Qadir, G., Shaheen, F. A. and Aslam, M. A. 2017. Response of proline accumulation in bread wheat (Triticum aestivum L.) under rainfed conditions. Journal of Agricultural Meteorology, 73: 147-155.
Astaraki, S., Atighi, M. R. and Shams-Bakhsh, M. 2023. Screening for tomato leaf curl Palampur virus resistance in common bean (Phaseolus vulgaris L.) cultivars through phytochemical characterization and enzyme activity analysis. Physiological and Molecular Plant Pathology, 126: 102043.
Astaraki, S., Safaie, N. and Bakhsh, M. S. 2020. Reaction of sugar beet, pepper and bean plants to co-infection with cucumber mosaic virus and beet curly top viruses. Iranian Journal of Plant Pathology, 56: 221-236.
Bennett, C. W. 1971. The Curly Top Disease of Sugarbeet and Other Plants. American Phytopathological Society, St. Paul.
Camp, S., Foote, P., Strausbaugh, C. A. and Gillen, A. M. 2005. Evaluation of commercial sugarbeet hybrids for resistance to beet curly top in Canyon county, ID, 2004. Biological and Cultural Tests for Control of Plant Diseases, 20: FC023.
Carillo, P. and Gibon, Y. 2011. Protocol: extraction and determination of proline. PrometheusWiki, 1-5.
Chang, C. C., Yang, M. H., Wen, H. M. and Chern, J. C. 2002. Estimation of total flavonoid content in propolis by two complementary colometric methods. Journal of Food and Drug Analysis, 10: 178-182.
Cheaib, A. and Killiny, N. 2025. Photosynthesis responses to the infection with plant pathogens. Molecular Plant-Microbe Interactions, 38: 9-29.
Chen, Y. E., Cui, J. M., Su, Y. Q., Yuan, S., Yuan, M. and Zhang, H. Y. 2015. Influence of stripe rust infection on the photosynthetic characteristics and antioxidant system of susceptible and resistant wheat cultivars at the adult plant stage. Frontiers in Plant Science, 6: 1-11.
Corrado, C. L., Micali, G., Mauceri, A., Bertin, S., Sunseri, F., Abenavoli, M. R. and Tiberini, A. 2024. Study on italian onion cultivars/ecotypes towards onion yellow dwarf virus (OYDV) infection. Horticulturae, 10.
Dahlem Junior, M. A., Nguema Edzang, R. W., Catto, A. L. and Raimundo, J. M. 2022. Quinones as an efficient molecular scaffold in the antibacterial/antifungal or antitumoral arsenal. International Journal of Molecular Sciences, 23.
Dar, M. I., Naikoo, M. I., Rehman, F., Naushin, F. and Khan, F. A. 2016. Proline accumulation in plants: roles in stress tolerance and plant development. In: Iqbal, N., Nazar, R. and Khan, N. A., (Eds.), Osmolytes and Plants Acclimation to Changing Environment: Emerging Omics Technologies. Springer India, pp. 155-166.
Debona, D., Rodrigues, F. Á., Rios, J. A. and Nascimento, K. J. T. 2012. Biochemical changes in the leaves of wheat plants infected by Pyricularia oryzae. Phytopathology, 102: 1121-1129.
Doyle, J. J. and Doyle, J. L. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin, 19: 11-15.
Fatahi, Z., Behjatnia, S. A. A., Afsharifar, A., Hamzehzarghani, H. and Izadpanah, K. 2012. Screening of sugar beet cultivars for resistance to Iranian isolate of beet severe curly top virus using an infectious clone of the virus. Iranian Journal of Plant Pathology, 48: 111-121.
Friedman, M. 2007. Overview of antibacterial, antitoxin, antiviral, and antifungal activities of tea flavonoids and teas. Molecular Nutrition & Food Research, 51: 116-134.
Grimsley, N., Hohn, I., Hohn, T. and Waldent, R. 1986. “Agroinfection,” an alternative route for viral infection of plants by using the Ti plasmid. Proceedings of the National Academy of Sciences, 83: 3282-3286.
Gupta, A., Patil, M., Qamar, A. and Senthil-Kumar, M. 2020. ath-miR164c influences plant responses to the combined stress of drought and bacterial infection by regulating proline metabolism. Environmental and Experimental Botany, 172: 103998.
Harveson, R., Hanson, L. and Hein, G. 2009. Compendium of Beet Diseases and Pests. American Phytopathological Society, APS Press.
Heydarnejad, J., Hosseini Abhari, E., Bolok Yazdi, H. R. and Massumi, H. 2007. Curly top of cultivated plants and weeds and report of a unique curtovirus from Iran. Journal of Phytopathology, 155: 321-325.
Heydarnejad, J., Keyvani, N., Razavinejad, S., Massumi, H. and Varsani, A. 2013. Fulfilling Koch’s postulates for beet curly top Iran virus and proposal for consideration of new genus in the family Geminiviridae. Archives of Virology, 158: 435-443.
Jahanbin, D., Izadpanah, K. and Behjatnia, S. A. A. 2015. Comparison of natural and experimental host range of beet severe curly top, beet curly top Iran and tomato yellow leaf curl viruses. Iranian Journal of Plant Pathology, 51: 505-521.
Laohavisit, A., Wakatake, T., Ishihama, N., Mulvey, H., Takizawa, K., Suzuki, T. and Shirasu, K. 2020. Quinone perception in plants via leucine-rich-repeat receptor-like kinases. Nature, 587: 92-97.
Lapidot, M. 2002. Screening common bean (Phaseolus vulgaris) for resistance to tomato yellow leaf curl virus. Plant Disease, 86: 429-432.
Lee, D., Ahn, S., Cho, H. Y., Yun, H. Y., Park, J. H., Lim, J., Lee, J. and Kwon, S. W. 2016. Metabolic response induced by parasitic plant-fungus interactions hinder amino sugar and nucleotide sugar metabolism in the host. Scientific Reports, 6: 37434.
Liu, M., Kang, B., Wu, H., Aranda, M. A., Peng, B., Liu, L., Fei, Z., Hong, N. and Gu, Q. 2023. Transcriptomic and metabolic profiling of watermelon uncovers the role of salicylic acid and flavonoids in the resistance to cucumber green mottle mosaic virus. Journal of Experimental Botany, 74: 5218-5235.
Livak, K. J. and Schmittgen, T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods, 25: 402-408.
Lobato, A. K. S., Gonçalves-Vidigal, M. C., Vidigal Filho, P. S. andrade, C. A. B., Kvitschal, M. V. and Bonato, C. M. 2010. Relationships between leaf pigments and photosynthesis in common bean plants infected by anthracnose. New Zealand Journal of Crop and Horticultural Science, 38: 29-37.
Madhumitha, B., Karthikeyan, A., Devi, G. P., Aiyanathan, K. E. A. and Sudha, M. 2020. Comparative evaluation of biochemical changes in the leaves of resistant and susceptible mungbean plants infected by mungbean yellow mosaic virus. Research Journal of Biotechnology, 15: 47-52.
Madhusudhan, K. N., Srikanta, B. M., Shylaja, M. D., Prakash, H. S. and Shetty, H. S. 2009. Changes in antioxidant enzymes, hydrogen peroxide, salicylic acid and oxidative stress in compatible and incompatible host-tobamovirus interaction. Journal of Plant Interactions, 4: 157-166.
Maehly, A. and Chance, B. 1954. The assay of catalases and peroxidases. Methods of Biochemical Analysis, 357-408.
Mafakheri, K., Astaraki, S., Safaie, N. and Shams-bakhsh, M. 2024. Seed bio-/chemo-priming affects the reaction of sugar beet plants to beet curly top virus-Svr. European Journal of Plant Pathology, 169: 473-482.
Mahfouze, H. A., Dougdoug, N. K. El, and Mahfouze, S. A. 2020. Virucidal activity of silver nanoparticles against banana bunchy top virus (BBTV) in banana plants. Bulletin of the National Research Centre, 44: 1-11.
Majidi, A., Hamzehzarghani, H., Izadpanah, K. and Behjatnia, S. A. A. 2017. Interaction between beet curly top Iran virus and the severe isolate of beet curly top virus in three selective sugar beet cultivars. Journal of Plant Pathology, 99: 381-389.
Mehetre, G. T., Leo, V. V., Singh, G., Sorokan, A., Maksimov, I., Yadav, M. K., Upadhyaya, K., Hashem, A., Alsaleh, A. N., Dawoud, T. M., Almaary, K. S. and Singh, B. P. 2021. Current developments and challenges in plant viral diagnostics: A systematic review. Viruses, 13: 1-31.
Mittler, R. 2002. Oxidative stress, antioxidants and stress tolerance. Trends in Plant Science, 7: 405-410.
Montazeri, R., Shams-Bakhsh, M., Mahmoudi, S. B. and Rajabi, A. 2016. Evaluation of sugar beet lines for resistance to beet curly top viruses. Euphytica, 210: 31-40.
Papaiah, S. and Narasimha, G. 2014. Peroxidase and polyphenol oxidase activities in healthy and viral infected sunflower (Helianthus annuus L.) leaves. BioTechnology: An Indian Journal, 9: 1-5.
Patel, S. K., Rajeswari, B. and Krishnaveni, D. 2018. Effect of rice tungro disease (RTD) on physiological changes of promising effect of rice tungro disease ( RTD ) on physiological changes of promising rice genotypes. International Journal of Agriculture Environment and Biotechnology, 999-1008.
Retig, N. 1974. Changes in peroxidase and polyphenoloxidase associated with natural and induced resistance of tomato to Fusarium wilt. Physiological Plant Pathology, 4: 145-150.
Saadati, M., Ayyari, M. and Shams-Bakhsh, M. 2022. Effect of the cucumber mosaic virus-Fny infection on the physiological and phytochemical properties of three green basil (Ocimum basilicum L.) landraces. Iranian Journal of Plant Pathology, 57: 303-319.
Saadati, M., Rajabi, A. and Shams-Bakhsh, M. 2021. Identification of resistant sugar beet (Beta vulgaris L.) genotypes against beet curly top disease. Journal of Agricultural Science and Technology, 23: 473-484.
Sedano, M., Lam, N., Escobar, I., Cross, T., Hanson, S. F. and Creamer, R. 2012. Application of vascular puncture for evaluation of curtovirus resistance in chile pepper and tomato. Journal of Phytopathology, 160: 120-128.
Shah, D. A. and Madden, L. V. 2004. Nonparametric analysis of ordinal data. Phytopathology, 94: 33-43.
Siddique, Z., Akhtar, K. P., Hameed, A., Sarwar, N., Imran-Ul-Haq, and Khan, S. A. 2014. Biochemical alterations in leaves of resistant and susceptible cotton genotypes infected systemically by cotton leaf curl Burewala virus. Journal of Plant Interactions, 9: 702-711.
Siguemoto, É. S. and Gut, J. A. W. 2017. Validation of spectrophotometric microplate methods for polyphenol oxidase and peroxidase activities analysis in fruits and vegetables. Food Science and Technology, 37: 148-153.
Singh, Y. J., Grewal, S. K. and Gill, R. K. 2021. Proline metabolism and phenylpropanoid pathway act independently in conferring resistance against yellow mosaic virus infection in black gram. Physiological and Molecular Plant Pathology, 116: 101713.
Sofy, A. R., Dawoud, R. A., Sofy, M. R., Mohamed, H. I., Hmed, A. A. and El-Dougdoug, N. K. 2020. Improving regulation of enzymatic and non-enzymatic antioxidants and stress-related gene stimulation in cucumber mosaic cucumovirus-infected cucumber plants treated with glycine betaine, chitosan and combination. Molecules, 25: 2341.
Soleimani, R., Matic, S., Taheri, H., Behjatnia, S. A. A., Vecchiati, M., Izadpanah, K. and Accotto, G. P. 2013. The unconventional geminivirus beet curly top Iran virus: Satisfying Koch’s postulates and determining vector and host range. Annals of Applied Biology, 162: 174-181.
Soni, S. K., Mishra, M., Mishra, M., Kumari, S., Saxena, S., Shukla, V., Tiwari, S. and Shirke, P. 2022. Papaya leaf curl virus (PaLCuV) infection on papaya (Carica papaya L.) plants alters anatomical and physiological properties and reduces bioactive components. Plants, 11: 579.
Srivastava, S. K. 1987. Peroxidase and poly‐phenol oxidase in Brassica juncea plants infected with Macrophomina phaseolina (Tassai) goid. and their Implication in Disease Resistance. Journal of Phytopathology, 120: 249-254.
Strausbaugh, C. A. and Fenwick, A. L. 2019. Beet curly top resistance in USDA-ARS Ft. Collins germplasm, 2018. Plant Disease Management Reports, 13.
Sulman, M., Fox, G., Osman, A., Inkerman, A., Williams, P. and Michalowitz, M. 2001. Relationship between total peroxidase activity and susceptibility to black point in mature grain of some barley cultivars. Proceeding 10th Australian Barley Technical Symposium, 16-20.
Swiech, R., Browning, S., Molsen, D., Stenger, D. C. and Holbrook, G. P. 2001. Photosynthetic responses of sugar beet and Nicotiana benthamiana Domin. infected with beet curly top virus. Physiological and Molecular Plant Pathology, 58: 43-52.
Taheri, H., Izadpanah, K. and Behjatnia, S. A. A. 2012. Circulifer haematoceps, the vector of the beet curly top Iran virus. Iranian Journal of Plant Pathology, 48.
Varsani, A., Martin, D. P., Navas-Castillo, J., Moriones, E., Hernández-Zepeda, C., Idris, A., Murilo Zerbini, F. and Brown, J. K. 2014. Revisiting the classification of curtoviruses based on genome-wide pairwise identity. Archives of Virology, 159: 1873-1882.
Velasquez-Valle, R., Mena-Covarrubias, J., Reveles-Torres, L. R., Argüello-Astorga, G. R., Salas-Luevano, M. A. and Mauricio-Castillo, J. A. 2012. First report of beet mild curly top virus in dry bean in Zacatecas, Mexico. Plant Disease, 96: 771-771.
Wang, K. L., Deng, Q. Q., Chen, J. W. and Shen, W. K. 2020. Physiological and molecular mechanisms governing the effect of virus-free chewing cane seedlings on yield and quality. Scientific Reports, 10: 1-11.
Warren, C. R. 2008. Rapid measurement of chlorophylls with a microplate reader. Journal of Plant Nutrition, 31: 1321-1332.
Yazdi, H. R. B., Heydarnejad, J. and Massumi, H. 2008. Genome characterization and genetic diversity of beet curly top Iran virus: A geminivirus with a novel nonanucleotide. Virus Genes, 36: 539-545.
Yıldırım, K., Kavas, M., Kaya, R., Seçgin, Z., Can, C., Sevgen, I., Saraç, Ç. G. and Tahan, V., 2022. Genome-based identification of beet curly top Iran virus infecting sugar beet in Turkey and investigation of its pathogenicity by agroinfection. Journal of Virological Methods, 300: 114380.
Yıldırım, K., Kavas, M., Küçük, İ. S., Seçgin, Z. and Saraç, Ç. G. 2023. Development of highly efficient resistance to beet curly top Iran virus (Becurtovirus) in sugar beet (B. vulgaris) via CRISPR/Cas9 system. International Journal of Molecular Sciences, 24.
Zakaryan, H., Arabyan, E., Oo, A. and Zandi, K. 2017. Flavonoids: promising natural compounds against viral infections. Archives of Virology, 162: 2539-2551.
Zhang, Y., Xie, Z., Wang, R., Kutcher, H. R., Wang, Y. and Guo, Z. 2014. Single and mixed viral infection reduced growth and photosynthetic pigment content, damaged chloroplast ultrastructure and enhanced virus accumulation in oriental lily (Lilium auratum cv. Sorbonne). Philippine Agricultural Scientist, 97(2): 138-147.